Diseño y estandarización de una técnica para la amplificación isotérmica mediada por bucles (LAMP) para la detección del gen BCR-ABL1 en Leucemia Mieloide crónica (LMC)
Cargando...
Fecha
2023
Autores
Acosta Hoyos, Luis David
Garcés Viloria, Arelys
Título de la revista
ISSN de la revista
Título del volumen
Editor
Ediciones Universidad Simón Bolívar
Facultad de Ciencias Básicas y Biomédicas
Facultad de Ciencias Básicas y Biomédicas
Resumen
La leucemia mieloide crónica (LMC) se define como un síndrome mieloproliferativo crónico de origen clonal, que se genera de una célula madre, como consecuencia de la producción descontrolada de una proteína cinasa única BCR-ABL1 constitutivamente activa, generando un excesivo número de células mieloides en todos los estadios de maduración. Un diagnóstico rápido y costo efectivo de la enfermedad favorecería una intervención oportuna, evidenciada en la selección del tratamiento y traducido en una mejoría en la calidad de vida. En el presente estudio se estandarizará la técnica LAMP para el diagnóstico clínico de leucemia mieloide crónica a través de la detección del gen BCR-ABL1.
Actualmente el diagnóstico molecular de Leucemia mieloide crónica (LMC) se realiza a través de la técnica RT-PCR (reacción en cadena de la polimerasa), la cual es una técnica sensible y específica, sin embargo es compleja, laboriosa y requiere de termocicladores que permitan realizar variaciones en la temperatura para que ocurra la reacción de amplificación; la técnica LAMP, amplificación isotérmica mediada por lazos, es una reacción mucho más rápida y más práctica que la PCR, debido a que es llevada a cabo empleando una única temperatura, que puede ser otorgada por cualquier equipo que garantice la temperatura por al menos 30 minutos. De manera que, en mucho menor tiempo comparado con la RT- PCR se lograría tener una alternativa eficaz que mejoraría el pronóstico de la enfermedad y conduciría a mejores estrategias de tratamiento de los pacientes con LMC. Para lo cual se diseñó un estudio metodológico de la estandarización de una prueba diagnóstica a través de un estudio transversal de la amplificación isotérmica mediada por bucles (LAMP) para detección del gen BCR-ABL1 en Leucemia Mieloide crónica (LMC), que incluye un grupo de muestras de pacientes que padece la enfermedad, considerado caso y otro grupo que no tiene la enfermedad, controles. Los resultados son comparados con una prueba de referencia o Gold Standard (Rt- PCR).
Se seleccionaron 5 muestras positivas con diagnóstico molecular conocido por RT-qPCR para el gen BCR-ABL1 y 5 muestras negativas con diagnostico conocido por RT-qPCR para el gen BCR- ABL1. Cada muestra fue procesada por triplicado, luego se realizó la extracción del ARN. Los ARN extraídos de las muestras positivas y negativas verificadas previamente por RT-qPCR se usaron para llevar a cabo la reacción RT-LAMP.
Con el fin de estandarizar el tiempo óptimo del cambio de color de la reacción, la prueba LAMP se incubó a diferentes tiempos, 30, 35, 40 y 45 minutos.
El cambio de color de rosa al amarillo fue indicativo de una reacción positiva. En las reacciones que se mantuvo el color rosa del reactivo LAMP fue señal de negatividad para el gen BCR- ABL1.
Cada muestra extraída se procedió a procesar por triplicado obteniéndose un total de 30 repeticiones.
Con la finalidad de obtener un producto puro de gen BCR- ABL y posteriormente poder realizar una cuantificación más exacta de este, se realiza PCR para lograr la amplificación el gen BCR-ABL1 esperando un fragmento de 500 pb empleando los primers: Forward: 5´AATCATATGCTGTCGGGAATCCTGGCTA 3´, Revers: 5´AATCATATGAGTGCAACGAAAAGGTTGGG 3´ y se realizó una RT- PCR.
A partir del amplificado se realizó un corrido electroforético para confirmar el peso del producto obtenido, empleando gel de agarosa al 1 % a 80 voltios por 60 minutos, usando un marcador de peso molecular de 500 pb.
Con el propósito de obtener más producto del gen (BCR-ABL) y posteriormente cuantificarlo para poder lograr establecer la sensibilidad de la prueba, se realizó una segunda PCR convencional a partir del producto amplificado.
Las condiciones de la amplificación fueron: 1 ciclo de 95°C por 1 minuto,40 ciclos de 95°C por 15 segundo, 64 °C por 30 segundos y 72°C por 2 minutos, seguido de una extensión final a 72°c por 10 min. Se verificó la amplificación del producto a partir de electroforesis en gel de agarosa al 1%, a 80 voltios por 80 minutos.
Del producto purificado se realizó una verificación de la concertación a través de NanoDrop. La sensibilidad se expresó como la fracción de muestras que resultaron positivas en la PCR y, también, en la RT-LAMP.
La especificidad de la prueba RT-LAMP se calculó de la fracción de muestras con RT-qPCR negativas que también resultaron negativas en las pruebas de RT-LAMP. Se calculó el valor predictivo positivo y el negativo, además del índice kappa (κ) para determinar la concordancia de los resultados de la RT-LAMP con los de la RT- qPCR. Se observó que todas las muestras incluyendo el control negativo (agua en lugar de muestra de ARN) se mantenían color rosa, por lo que se sugirió que el tiempo de 30 minutos no fue suficiente para detección de al menos una muestra positiva. Se realizó incubación isotérmica 65°C por 35 minutos a las mismas muestras y se observó el mismo comportamiento, ninguna muestra resultó positiva para el gen BCR-ABL1, por lo que este tiempo tampoco fue suficiente para detectar el BCR- ABL1 por RT-LAMP. Se incubó por 40 minutos, obteniéndose un ligero cambio de color en 3 muestras, el resto de las muestras incluyendo el control negativo, permanecían color rosa. Se incubó por 45 minutos y se observó que 5 de las muestras evaluadas en la corrida cambiaron de color, de rosa a amarillo, y 5 muestras permanecían color rosa al igual que el control negativo. por lo que se estableció que 45 minutos es el tiempo necesario de la reacción isotérmica RT-LAMP para detección del gen BCR-ABL1. De los ensayos anteriores se obtuvo una sensibilidad y especificidad del 100% en las muestras evaluadas pudiendo discriminar entre pacientes y controles.
Chronic myeloid leukemia (CML) is defined as a chronic myeloproliferative syndrome of clonal origin, arising from a stem cell, resulting in the uncontrolled production of a constitutively active BCR-ABL1 kinase protein. This leads to an excessive number of myeloid cells at all stages of maturation. A rapid and cost-effective diagnosis of the disease would facilitate timely intervention, reflected in treatment selection and improved quality of life. In this study, the LAMP technique will be standardized for the clinical diagnosis of chronic myeloid leukemia by detecting the BCR-ABL1 gene. Currently, the molecular diagnosis of chronic myeloid leukemia (CML) is performed using the RT-PCR (reverse transcription-polymerase chain reaction) technique, which is sensitive and specific but complex, labor-intensive, and requires thermocyclers for temperature variations during the amplification reaction. The LAMP technique, loop-mediated isothermal amplification, is a faster and more practical reaction compared to PCR because it can be carried out at a single temperature, which can be maintained by any equipment capable of maintaining the temperature for at least 30 minutes. Thus, in much less time compared to RT-PCR, an effective alternative would be achieved, improving the prognosis of the disease and leading to better treatment strategies for CML patients. Therefore, a methodological study was designed to standardize a diagnostic test using a cross-sectional study of loop-mediated isothermal amplification (LAMP) for detecting the BCR-ABL1 gene in chronic myeloid leukemia (CML), including a group of patients with the disease (cases) and another group without the disease (controls). The results are compared with a reference or gold standard test (RT-PCR). Five positive samples with a known molecular diagnosis for the BCR-ABL1 gene by RT-qPCR and five negative samples with a known diagnosis for the BCR-ABL1 gene by RT-qPCR were selected. Each sample was processed in triplicate, and RNA extraction was performed. The extracted RNA from the previously verified positive and negative samples by RT-qPCR was used to carry out the RT-LAMP reaction. In order to standardize the optimal color change time for the reaction, the LAMP test was incubated at different times: 30, 35, 40, and 45 minutes. The change from pink to yellow indicated a positive reaction, while a maintained pink color of the LAMP reagent indicated negativity for the BCR-ABL1 gene. Each extracted sample was processed in triplicate, resulting in a total of 30 repetitions. To obtain a pure product of the BCR-ABL gene and subsequently perform a more accurate quantification, PCR was performed to amplify the BCR-ABL1 gene, targeting a fragment of 500 bp using the following primers: Forward: 5´AATCATATGCTGTCGGGAATCCTGGCTA 3´, Reverse: 5´AATCATATGAGTGCAACGAAAAGGTTGGG 3´, and an RT-PCR was performed. Based on the amplification, an electrophoretic run was performed to confirm the size of the obtained product, using a 1% agarose gel at 80 volts for 60 minutes, with a 500 bp molecular weight marker. In order to obtain more of the gene product (BCR-ABL) and subsequently quantify it to establish the sensitivity of the test, a second conventional PCR was performed using the amplified product. The amplification conditions were as follows: 1 cycle at 95°C for 1 minute, 40 cycles at 95°C for 15 seconds, 64°C for 30 seconds, and 72°C for 2 minutes, followed by a final extension at 72°C for 10 minutes. The amplification of the product was verified by agarose gel electrophoresis at 1%, at 80 volts for 80 minutes. The concentration of the purified product was verified using NanoDrop. The sensitivity was expressed as the fraction of samples that tested positive in PCR and RT-LAMP. The specificity of the RT-LAMP test was calculated as the fraction of samples with negative RT-qPCR results that also tested negative in the RT-LAMP tests. The positive predictive value, negative predictive value, and kappa (κ) index were calculated to determine the concordance of the RT-LAMP results with the RT-qPCR results. It was observed that all samples, including the negative control (water instead of RNA sample), remained pink, suggesting that the 30-minute incubation time was not sufficient to detect at least one positive sample. Isothermal incubation was performed at 65°C for 35 minutes on the same samples, and the same behavior was observed: no sample tested positive for the BCR-ABL1 gene, indicating that this time was also insufficient for BCR-ABL1 detection by RT-LAMP. Incubation for 40 minutes resulted in a slight color change in 3 samples, while the rest of the samples, including the negative control, remained pink. After 45 minutes of incubation, 5 out of the evaluated samples changed color from pink to yellow, while 5 samples remained pink, similar to the negative control. Therefore, it was established that 45 minutes is the required time for the RT-LAMP isothermal reaction to detect the BCR-ABL1 gene. From the previous assays, a sensitivity and specificity of 100% was obtained in the evaluated samples, allowing discrimination between patients and controls.
Chronic myeloid leukemia (CML) is defined as a chronic myeloproliferative syndrome of clonal origin, arising from a stem cell, resulting in the uncontrolled production of a constitutively active BCR-ABL1 kinase protein. This leads to an excessive number of myeloid cells at all stages of maturation. A rapid and cost-effective diagnosis of the disease would facilitate timely intervention, reflected in treatment selection and improved quality of life. In this study, the LAMP technique will be standardized for the clinical diagnosis of chronic myeloid leukemia by detecting the BCR-ABL1 gene. Currently, the molecular diagnosis of chronic myeloid leukemia (CML) is performed using the RT-PCR (reverse transcription-polymerase chain reaction) technique, which is sensitive and specific but complex, labor-intensive, and requires thermocyclers for temperature variations during the amplification reaction. The LAMP technique, loop-mediated isothermal amplification, is a faster and more practical reaction compared to PCR because it can be carried out at a single temperature, which can be maintained by any equipment capable of maintaining the temperature for at least 30 minutes. Thus, in much less time compared to RT-PCR, an effective alternative would be achieved, improving the prognosis of the disease and leading to better treatment strategies for CML patients. Therefore, a methodological study was designed to standardize a diagnostic test using a cross-sectional study of loop-mediated isothermal amplification (LAMP) for detecting the BCR-ABL1 gene in chronic myeloid leukemia (CML), including a group of patients with the disease (cases) and another group without the disease (controls). The results are compared with a reference or gold standard test (RT-PCR). Five positive samples with a known molecular diagnosis for the BCR-ABL1 gene by RT-qPCR and five negative samples with a known diagnosis for the BCR-ABL1 gene by RT-qPCR were selected. Each sample was processed in triplicate, and RNA extraction was performed. The extracted RNA from the previously verified positive and negative samples by RT-qPCR was used to carry out the RT-LAMP reaction. In order to standardize the optimal color change time for the reaction, the LAMP test was incubated at different times: 30, 35, 40, and 45 minutes. The change from pink to yellow indicated a positive reaction, while a maintained pink color of the LAMP reagent indicated negativity for the BCR-ABL1 gene. Each extracted sample was processed in triplicate, resulting in a total of 30 repetitions. To obtain a pure product of the BCR-ABL gene and subsequently perform a more accurate quantification, PCR was performed to amplify the BCR-ABL1 gene, targeting a fragment of 500 bp using the following primers: Forward: 5´AATCATATGCTGTCGGGAATCCTGGCTA 3´, Reverse: 5´AATCATATGAGTGCAACGAAAAGGTTGGG 3´, and an RT-PCR was performed. Based on the amplification, an electrophoretic run was performed to confirm the size of the obtained product, using a 1% agarose gel at 80 volts for 60 minutes, with a 500 bp molecular weight marker. In order to obtain more of the gene product (BCR-ABL) and subsequently quantify it to establish the sensitivity of the test, a second conventional PCR was performed using the amplified product. The amplification conditions were as follows: 1 cycle at 95°C for 1 minute, 40 cycles at 95°C for 15 seconds, 64°C for 30 seconds, and 72°C for 2 minutes, followed by a final extension at 72°C for 10 minutes. The amplification of the product was verified by agarose gel electrophoresis at 1%, at 80 volts for 80 minutes. The concentration of the purified product was verified using NanoDrop. The sensitivity was expressed as the fraction of samples that tested positive in PCR and RT-LAMP. The specificity of the RT-LAMP test was calculated as the fraction of samples with negative RT-qPCR results that also tested negative in the RT-LAMP tests. The positive predictive value, negative predictive value, and kappa (κ) index were calculated to determine the concordance of the RT-LAMP results with the RT-qPCR results. It was observed that all samples, including the negative control (water instead of RNA sample), remained pink, suggesting that the 30-minute incubation time was not sufficient to detect at least one positive sample. Isothermal incubation was performed at 65°C for 35 minutes on the same samples, and the same behavior was observed: no sample tested positive for the BCR-ABL1 gene, indicating that this time was also insufficient for BCR-ABL1 detection by RT-LAMP. Incubation for 40 minutes resulted in a slight color change in 3 samples, while the rest of the samples, including the negative control, remained pink. After 45 minutes of incubation, 5 out of the evaluated samples changed color from pink to yellow, while 5 samples remained pink, similar to the negative control. Therefore, it was established that 45 minutes is the required time for the RT-LAMP isothermal reaction to detect the BCR-ABL1 gene. From the previous assays, a sensitivity and specificity of 100% was obtained in the evaluated samples, allowing discrimination between patients and controls.
Descripción
Palabras clave
Leucemia Mieloide Crónica, BCR-ABL1, LAMP, sensibilidad y especificidad, PCR, Chronic Myeloid Leukemia, sensitivity and specificity
